gcbenison.wordpress.com
GCBLOG | Algorithms – in code, and elsewhereAlgorithms - in code, and elsewhere
http://gcbenison.wordpress.com/
Algorithms - in code, and elsewhere
http://gcbenison.wordpress.com/
TODAY'S RATING
>1,000,000
Date Range
HIGHEST TRAFFIC ON
Saturday
LOAD TIME
1.1 seconds
16x16
32x32
PAGES IN
THIS WEBSITE
14
SSL
EXTERNAL LINKS
18
SITE IP
192.0.78.12
LOAD TIME
1.078 sec
SCORE
6.2
GCBLOG | Algorithms – in code, and elsewhere | gcbenison.wordpress.com Reviews
https://gcbenison.wordpress.com
Algorithms - in code, and elsewhere
gcbenison.wordpress.com
August | 2011 | GCBLOG
https://gcbenison.wordpress.com/2011/08
Algorithms – in code, and elsewhere. Archive for August, 2011. API discovery with Scheme. On August 2, 2011 by gcbenison. Is a widely-accepted standard, well-supported in the most common web development languages. But the whole point of an open standard is that one ought to be able work with it in any. Language and on any. So when my 13-year-old brother-in-law Lucien and I arrived at APIhackday. We decided to work with web API’s in two of our favorite languages – lua. And using the CouncilConnect stream,...
May | 2012 | GCBLOG
https://gcbenison.wordpress.com/2012/05
Algorithms – in code, and elsewhere. Archive for May, 2012. The logic bomb that helped me embrace free scientific software. On May 15, 2012 by gcbenison Tagged: free software. Are freely available online, but both original. 8211; even while arguing for more openness in science – sit behind massive paywalls, an irony that has been picked up. By other observers as well. Open access. Has long troubled me. One incident in particular brought the issue into sharp focus in my mind. 8220;This program and its rel...
June | 2012 | GCBLOG
https://gcbenison.wordpress.com/2012/06
Algorithms – in code, and elsewhere. Archive for June, 2012. DNA sequence annotation: a graph coloring problem. On June 18, 2012 by gcbenison Tagged: dna. In this post I will explore methods for annotating DNA sequences with translated ORFs, like so:. 1870 1880 1890 1900 1910 1920 TGCTCACCAATGTACATGGCCTTAATCTGGAAAACTGGCAGGAAGAACTGGCGCAAGCCA euLeuThrAsnValHisGlyLeuAsnLeuGluAsnTrpGlnGluGluLeuAlaGlnAlaL MetAlaLeuIleTrpLysThrGlyArgLysAsnTrpArgLysPro MetTyrMetAlaLeuIleTrpLysThrGlyArgLysAsnTrpArgLysPro. Let ea...
February | 2012 | GCBLOG
https://gcbenison.wordpress.com/2012/02
Algorithms – in code, and elsewhere. Archive for February, 2012. You’re only using PHP because you don’t have Guile and (sxml simple). On February 19, 2012 by gcbenison Tagged: lisp dialect. OK, maybe you would still use PHP even if you did have a Scheme implementation. And the (sxml simple) module. But it is true that just about any web application written in PHP could also be written in Scheme. Or another Lisp dialect. And yes you can get it hosted. There are even complete Lisp web. Both HTML and many ...
April | 2012 | GCBLOG
https://gcbenison.wordpress.com/2012/04
Algorithms – in code, and elsewhere. Archive for April, 2012. Deploying a Scheme web application: the Taubatron. On April 23, 2012 by gcbenison Tagged: scheme. This is the story of how I deployed the Taubatron. 8211; a web application written in Scheme. I wrote about what it does. Earlier; this post is concerned with getting it running on the actual internet, as opposed to on my personal computer. CGI vs server process. But for this application, performance with CGI was a problem –. I considered mod lisp.
TOTAL PAGES IN THIS WEBSITE
14
sciclips | Sciclips's Blog
https://sciclips.wordpress.com/author/sciclips
Sciclips Disease Database and Disease Discussion-Networking Forum. On: June 6, 2013. Strategies for Rational and Personalized Cancer Biomarker Discovery. Cancer Biomarker Strategy to Develop Companion Diagnostics for Predicting Prescription Drug Induced Tumors – Analysis using pioglitazone (Actos) and bladder cancer. Cancer Theranostics – Potential Applications of Cancer Biomarker Database. How to Identify Clinically Successful Biomarkers? Gene Patents may Hamper Innovations in Patient Care. On the contr...
Why Mac is probably a better OS to work on for a web developer | teknonics
https://teknonics.wordpress.com/2012/06/07/why-mac-is-probably-a-better-os-to-work-on-for-a-web-developer
PHP: After the basics. Graphic and UI Design. Why Mac is probably a better OS to work on for a web developer. This entry was posted on June 7, 2012, in Linux. Technology and Start Ups. If you know me you would have read the title with eyes wide open. I am one of those (and well-known for being those) who always take the side of Windows. Inside Windows internally connected via multiple networks (internet, file sharing etc.). A few things that I hated while developing on windows are:. I believe every devel...
Better use of a Getter method in PHP | IndividualWeb
https://individualweb.wordpress.com/2012/02/25/better-use-of-a-getter-method-in-php
Let's become great programmers together! Better use of a Getter method in PHP. You are probably familiar with getters and setters in object-oriented code. Usually they are something like this:. Public function GetId(){ return $this- id; } public function SetId($value=0){ $this- id = $value; }. Normally I improve these two methods by setting them into one method, like this:. Public function Id($value=null){ if($value = null){ return $this- id; } else { $this- id = $value; } }. Feed You can leave a response.
SQL: the successful cousin of Haskell | Experimental Thoughts
http://thoughts.davisjeff.com/2011/09/25/sql-the-successful-cousin-of-haskell
Ideas on Databases, Logic, and Language by Jeff Davis. Skip to primary content. Skip to secondary content. SQL: the successful cousin of Haskell. September 25, 2011. Haskell is a very interesting language, and shows up on sites like http:/ programming.reddit.com. But discussion on sites like reddit usually falls a little flat when someone asks a question like:. If haskell has all these wonderful advantages, what amazing applications have been written with it? Tightly controlled side effects. In so many c...
Haskell Problem 6 | prat
https://prat7.wordpress.com/2011/12/27/haskell-problem-6
Com Sci, Cog Sci, Programming and My Life. December 27, 2011. Find out whether a list is a palindrome. A palindrome can be read forward or backward; e.g. (x a m a x). I struggled with this problem because I haven’t studied much about type. So I asked question: stackoverflow.com/questions/8628575/why-cant-i-write-a-general-function-to-check-if-two-lists-are-equal. 8220;Given two values of an. Type, Haskell does not necessarily know how to compare them for equality. Next post →. December 28, 2011. You are ...
Announcing planar-graph | «Insert Name Here»
https://ivanmiljenovic.wordpress.com/2012/04/27/announcing-planar-graph
Greetings and salutations be upon thee to my little corner of what we like to charmingly call "the internet". A crazy idea about graph visualisation. Getting into blogging before it's too late. I’ve been working on a new planar graph library. On and off for just over the past year. What is a graph? Of a graph is as follows:. A graph is an ordered pair. Of vertices or nodes together with a set. Of edges or lines, which are 2-element subsets of. However, this isn’t ideal:. Using this representation implici...
HTTP Methods – and Servlets | Web Rolls
https://caleem.wordpress.com/2012/04/03/http-methods-and-servlets
Its a change that keeps you running. Skip to primary content. HTTP Methods – and Servlets. April 3, 2012. When we communicate to a web server the communication take place with the help of request and response methodology, the most common way for client server communication is over HTTP. Ie hyper text transfer protocol. HTTP. Protocol to communicate to server, a HTTP server. Listen to some port for client request and on receiving any request server send response to that particular request. All these metho...
The Alternate Allele: Populate LinkedIn Publications using PubMed IDs
http://alternateallele.blogspot.com/2011/02/populate-linkedin-publications-using.html
Bioinformatics tips, tales and hacks from the frontline. Wednesday, February 2, 2011. Populate LinkedIn Publications using PubMed IDs. Note: The LinkedIn-PubMed script has been updated and is discussed here. To install the script:. Install the GreaseMonkey Firefox extension by going here. And hitting "Add to Firefox". Install the LinkedIn-PubMed ID Lookup script by going here. Here are screen shots of what the LinkedIn page looks like before you install the script:. I was able to successfully enter all m...
Good Developer, Bad Developer - Thoughts from my startup journey
http://www.guynirpaz.com/2012/06/11/good-developer-bad-developer
Thoughts from my startup journey. Random thoughts and ideas. Subscribe to Blog via Email. Enter your email address to subscribe to this blog and receive notifications of new posts by email. My Answers on Quora. What are the differences between Totango and Gainsight? July 21, 2016. If CRM if for winning new customers, what is the software for retaining and expanding existing customers? June 27, 2016. Should customer success manager add graphics or images to their client emails? May 26, 2016. May 1, 2016.
Another Git branching model | Aurélien Pelletier
http://blogpro.toutantic.net/2012/01/02/another-git-branching-model
Web,Open source, Agile, Architecture, Java. Les Technologies de l’Information et de la Communication (TIC). Another Git branching model. We’ve switched to git at work a few month ago. Not an easy task but the rewards are worth the trouble. Our branching model was based on Git Flow. Because it’s well documented and gives you a structure to start with DVCS. Well, after a few iterations it wasn’t working as expected in our context. So we had to come up with our own workflow. We have three branches with an i...
TOTAL LINKS TO THIS WEBSITE
18
GCBelsey (Gemma Belsey) - DeviantArt
Window.devicePixelRatio*screen.width 'x' window.devicePixelRatio*screen.height) :(screen.width 'x' screen.height) ; this.removeAttribute('onclick')" class="mi". Window.devicePixelRatio*screen.width 'x' window.devicePixelRatio*screen.height) :(screen.width 'x' screen.height) ; this.removeAttribute('onclick')". Join DeviantArt for FREE. Forgot Password or Username? Deviant for 6 Years. This deviant's full pageview. March 31, 1990. Last Visit: 22 weeks ago. By moving, adding and personalizing widgets. So it...
New Virtual Private Server for New Jersey Telcomm -- newtelc.vwh.net
Welcome New Jersey Telcomm to Your New Virtual Private Server! We would like to welcome you to your new Virtual Private Server. We are committed to bringing you the best service and finest Internet hosting solutions available. To help you get acquainted with your Virtual Private Server we have prepared "Getting Started" pages on our Web site. We encourage you to visit these pages and add them to your list of bookmarks. Best wishes in using your new Virtual Private Server!
New Virtual Private Server for New Jersey Telcomm -- newtelc.vwh.net
Welcome New Jersey Telcomm to Your New Virtual Private Server! We would like to welcome you to your new Virtual Private Server. We are committed to bringing you the best service and finest Internet hosting solutions available. To help you get acquainted with your Virtual Private Server we have prepared "Getting Started" pages on our Web site. We encourage you to visit these pages and add them to your list of bookmarks. Best wishes in using your new Virtual Private Server!
Grupo Constructor Bemaro - Puebla
Consíguelo y compra tu casa en 3 pasos. 41 Poniente #717 Col. Gabriel Pastor, Puebla, Pue. 145-A Poniente #302, Puebla, Pue. Terrazza Plaza Calle 5 de mayo 1001 (esquina 10 Poniente)Local Num. 60 Primer Nivel, Puebla, Pue. El subsidio federal otorgado por la Conavi para adquirir una casa es un apoyo que busca que más mexicanos tengan acceso a una vivienda digna. Conoce cómo funciona y cómo te puede beneficiar. Si lo prefieres, podemos ayudarte a tramitar tu crédito: tú no tienes que preocuparte por eso!
www.gcbenefits.com
This site is under construction. Why am I seeing this page? Are you the owner of this domain? How to replace this page. Try these searches related to www.gcbenefits.com:.
GCBLOG | Algorithms – in code, and elsewhere
Algorithms – in code, and elsewhere. DNA sequence annotation: a graph coloring problem. On June 18, 2012 by gcbenison Tagged: dna. In this post I will explore methods for annotating DNA sequences with translated ORFs, like so:. 1870 1880 1890 1900 1910 1920 TGCTCACCAATGTACATGGCCTTAATCTGGAAAACTGGCAGGAAGAACTGGCGCAAGCCA euLeuThrAsnValHisGlyLeuAsnLeuGluAsnTrpGlnGluGluLeuAlaGlnAlaL MetAlaLeuIleTrpLysThrGlyArgLysAsnTrpArgLysPro MetTyrMetAlaLeuIleTrpLysThrGlyArgLysAsnTrpArgLysPro. Let each ORF be the vertex in ...
You say "obsessed" like it's a bad thing.
Upgrade to paid account! You say obsessed like its a bad thing. Where the hell is my crumpet, and why are you standing in my tea? Have some random writing. Oct 11th, 2011 at 2:58 PM. I was bored in class, so I wrote this in Psychology and typed it up in Earth Science. Its not much, its not titled, its not betad, but the severe lack of Peterick on LJ recently kills me on the inside. So enjoy. Aug 5th, 2011. Not that that's anyone's fault but my own. No one is hiring, and if they are, it's not me they're l...
you've always been just like a riddle...
Sun, Oct. 31st, 2010, 02:43 am. If you don't leave me a comment to say how we know eachother or how you found my journal, you will NOT be added. This is an active journal, just hidden from unwanted eyes. Wed, Nov. 12th, 2008, 04:10 pm. Fire In The Hole CD Release Show! Friday - November 21, 2008. Doors at 6PM. Show at 7PM. Tickets are $5 ( $5 at the doors for UNDER 21). Message the band on their myspace at. Fire In The Hole's CD will be for sale at the show for $10. Let me know if you have any questions.
G C and B Enterprises Inc
G C and B Enterprises Inc. Contact us at info@gcbent.com. A website created by GoDaddy’s Website Builder.
gcbenterprises.com
NOTICE: This domain name expired on 3/17/2018 and is pending renewal or deletion. Welcome to: gcbenterprises.com. This Web page is parked for FREE, courtesy of GoDaddy.com. Would you like to buy this. THE domain at THE price. Visit GoDaddy.com for the best values on. Restrictions apply. See website for details.
Home :: Golfclub Bentwoud
4 Wouden Wedstrijd (2e dag). Dames Matchplay (tweebal matchplay). Golfen doe je samen. Schrijf je in als lid. 2731 LD Benthuizen,. Telefoon: 0172 583 010,.
